Laserfiche WebLink
Figure 2 <br />GTCTTATCC CAT TG CCAA CT GGCA <br />DNA: 11111111111111111111 F7 <br />CAGAATAGGGTAACGGTTGACCGT <br />the I <br />nucleotides <br />transcription <br />I <br />mRNA : <br />GUCUUAUCCCAUUGCCAACUGGCA <br />cod on <br />I <br />translation <br />I <br />Protein: valine- leucine-serine-histidine-cy seeine-glutamine-leucine-alanine <br />one amino acid <br />Figure 2. Transcription and translation, a diagrammatic illustration of how genetic information passes from <br />DNA to mRNA to protein. DNA is used as a template for transcription of mRNA. The mRNA is used as a <br />template for protein synthesis during translation. Three nucleotides in DNA specify one codon in mRNA <br />and one amino-acid in the final protein. (After Strickberger 1976.) <br />8